<?xml version = "1.0" encoding = "UTF-8"?>
<serviceDescriptions  xmlns="pd" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="pd /C:/Documents and Settings/ytanoh/My Documents/TAVERNA/taverna-1.4-old/plugins/pedro/services/model/common.xsd">
	<serviceDescription >
		<serviceName>stssearch</serviceName>
		<organisation >
			<organisationName>European Bioinformatics Institute</organisationName>
		</organisation>

		<locationURL>http://www.ebi.ac.uk/soaplab/emboss4/services/nucleic_primers.stssearch</locationURL>
		<interfaceWSDL>http://www.ebi.ac.uk/soaplab/emboss4/services/nucleic_primers.stssearch?wsdl</interfaceWSDL>
		<serviceDescriptionText>Search a DNA database for matches with a set of STS primers. Detailed info about this operation can be found at the following link: http://emboss.sourceforge.net/apps/release/4.0/emboss/apps/stssearch.html</serviceDescriptionText>
		<operations >
			<serviceOperation >
				<operationName>stssearch</operationName>
				<operationDescriptionText>Search a DNA database for matches with a set of STS primers. Detailed info about this operation can be found at the following link: http://emboss.sourceforge.net/apps/release/4.0/emboss/apps/stssearch.html</operationDescriptionText>
				<operationInputs >
					<parameter >
						<parameterName>seqall_usa</parameterName>
						<parameterDescription>Type: string. DNA sequence. The Uniform Sequence Address, or USA, is a standard way of specifying a sequence to be read into a program in EMBOSS. The most common ways of specifying a sequence is to type (database:entry), where database can be embl, uniprot or swissprot and entry is either the sequence`s entry or ID name, or its Accession number in that database. For example, database:accession --&gt;embl:X65923 or swissprot:Q7M4G0 | database:entry_name --&gt;swissprot:AMIC_PSEAE |database:ID_name --&gt;embl:paamir. Choose either this parameter or the seqall_direct_data parameter but not both together. Parameter mandatory if the seqall_direct_data parameter has not been chosen.</parameterDescription>
						<isConfigurationParameter>false</isConfigurationParameter>
						<semanticType>http://www.mygrid.org.uk/ontology#EMBL_accession</semanticType>
						<transportDataType>String</transportDataType>
					</parameter>

					<parameter >
						<parameterName>seqall_direct_data</parameterName>
						<parameterDescription>Type: string. DNA sequence. Choose this parameter if you want to provide the &apos;seqall&apos; value as string (DNA sequence). Parameter mandatory if the seqall_usa parameter hasn&apos;t been chosen.</parameterDescription>
						<isConfigurationParameter>false</isConfigurationParameter>
						<transportDataType>String</transportDataType>
					</parameter>

					<parameter >
						<parameterName>sformat</parameterName>
						<parameterDescription>Type: string. Specifies the format of the input sequence. This is an optional parameter. The allowed values for this parameter are: gcg, gcg8, embl, swiss, fasta, ncbi, genbank, nbrf, pir, codata, strider, clustal, phylip, acedb, msf, jackknifer, jackknifernon, nexus, nexusnon, treecon, mega, meganon, ig, staden, text, raw. By default the service autodetects the sequence format.</parameterDescription>
						<isConfigurationParameter>false</isConfigurationParameter>
						<transportDataType>String</transportDataType>
					</parameter>

					<parameter >
						<parameterName>sbegin</parameterName>
						<parameterDescription>Type: long. The first position to be used in the sequence, for example: sbegin=1 (default value) means start with the first base in the sequence. This is an optional parameter.</parameterDescription>
						<isConfigurationParameter>false</isConfigurationParameter>
						<transportDataType>String</transportDataType>
					</parameter>

					<parameter >
						<parameterName>send</parameterName>
						<parameterDescription>Type: long. The last position to be used in the sequence. This is an optional parameter. By default it is the end the sequence.</parameterDescription>
						<isConfigurationParameter>false</isConfigurationParameter>
						<transportDataType>String</transportDataType>
					</parameter>

					<parameter >
						<parameterName>sprotein</parameterName>
						<parameterDescription>Type: boolean. Is the sequence a protein? This is an optional parameter. By default the service can autodetect if a sequence is a nucleotide or protein sequence.</parameterDescription>
						<isConfigurationParameter>false</isConfigurationParameter>
						<transportDataType>String</transportDataType>
					</parameter>

					<parameter >
						<parameterName>snucleotide</parameterName>
						<parameterDescription>Type: boolean. Is the sequence a nucleotide? This is an optional parameter. By default the service can autodetect if a sequence is a nucleotide or protein sequence.</parameterDescription>
						<isConfigurationParameter>false</isConfigurationParameter>
						<transportDataType>String</transportDataType>
					</parameter>

					<parameter >
						<parameterName>sreverse</parameterName>
						<parameterDescription>Type: boolean. Use reverse complement of the nucleic acid sequence. This is an optional parameter. False by default.</parameterDescription>
						<isConfigurationParameter>false</isConfigurationParameter>
						<transportDataType>String</transportDataType>
					</parameter>

					<parameter >
						<parameterName>slower</parameterName>
						<parameterDescription>Type: boolean. Convert the sequence to lower case. This is an optional parameter. False by default.</parameterDescription>
						<isConfigurationParameter>false</isConfigurationParameter>
						<transportDataType>String</transportDataType>
					</parameter>

					<parameter >
						<parameterName>supper</parameterName>
						<parameterDescription>Type: boolean. Convert the sequence to UPPER case. This is an optional parameter. False by default.</parameterDescription>
						<isConfigurationParameter>false</isConfigurationParameter>
						<transportDataType>String</transportDataType>
					</parameter>

					<parameter >
						<parameterName>infile_direct_data</parameterName>
						<parameterDescription>Type: string. Primer pairs. The primers Pair consists of three columns separated by tabs or spaces.
The first column is the name of the primer pair.
The second column is the sequence of the first primer.
The third column is the sequence of the second primer.
For example: 
PrimA ACCAGACACCCATCAACAG    TATTTATGCCAGCCAGCCAG |
PrimB CGAAAGAATAAGAGCAGGCAAG GTAAGAGAAATAGACAGGCGG |
This is a mandatory parameter and mutually exclusive with the &apos;infile_url&apos; parameter</parameterDescription>
						<isConfigurationParameter>false</isConfigurationParameter>
						<semanticType>http://www.mygrid.org.uk/ontology#DNA_sequence</semanticType>
						<transportDataType>String</transportDataType>
					</parameter>

					<parameter >
						<parameterName>infile_url</parameterName>
						<parameterDescription>Type: string. URL of Primer pairs. The primers Pair consists of three columns separated by tabs or spaces.
The first column is the name of the primer pair.
The second column is the sequence of the first primer.
The third column is the sequence of the second primer.
For example: 
PrimA ACCAGACACCCATCAACAG    TATTTATGCCAGCCAGCCAG |
PrimB CGAAAGAATAAGAGCAGGCAAG GTAAGAGAAATAGACAGGCGG |
This parameter is mutually exclusive with the &apos;infile_direct_data&apos; parameter.</parameterDescription>
						<isConfigurationParameter>false</isConfigurationParameter>
						<transportDataType>String</transportDataType>
					</parameter>

				</operationInputs>

				<operationOutputs >
					<parameter >
						<parameterName>report</parameterName>
						<parameterDescription>Type: string. A general report for the underlying analysis job.</parameterDescription>
						<transportDataType>String</transportDataType>
					</parameter>

					<parameter >
						<parameterName>detailed_status</parameterName>
						<parameterDescription>Type: long. The exit code of the underlying analysis job, 0 means the job returned normally.</parameterDescription>
						<transportDataType>String</transportDataType>
					</parameter>

					<parameter >
						<parameterName>outfile</parameterName>
						<parameterDescription>The output consists of one line per match. This consists of:
* The name of the sequence that the match is found in, followed by a &apos;:&apos;.  
* If the match is in the reverse sense, it has a &apos;(rev)&apos;.
* The name of the primer pair.
* &apos;PrimerA&apos; or &apos;PrimerB&apos;.
* &apos;matched at&apos; the start of the match position.</parameterDescription>
						<semanticType>http://www.mygrid.org.uk/ontology#primer_report</semanticType>
						<transportDataType>String</transportDataType>
					</parameter>

				</operationOutputs>

				<operationTask>http://www.mygrid.org.uk/ontology#pairwise_local_aligning</operationTask>
				<operationResource>http://www.mygrid.org.uk/ontology#EMBL_nucleotide_sequence_database</operationResource>
			</serviceOperation>

		</operations>

		<serviceType>Soaplab service</serviceType>
	</serviceDescription>

</serviceDescriptions>
