primersearch European Bioinformatics Institute http://www.ebi.ac.uk/soaplab/emboss4/services/nucleic_primers.primersearch http://www.ebi.ac.uk/soaplab/emboss4/services/nucleic_primers.primersearch?wsdl Reads in primer pairs and searches them against sequence(s) specified by the user. Detailed info about this operation can be found at the following link: http://emboss.sourceforge.net/apps/release/4.0/emboss/apps/primersearch.html primersearch Reads in primer pairs and searches them against sequence(s) specified by the user. Detailed info about this operation can be found at the following link: http://emboss.sourceforge.net/apps/release/4.0/emboss/apps/primersearch.html seqall_usa Type: string. DNA sequence. The Uniform Sequence Address, or USA, is a standard way of specifying a sequence to be read into a program in EMBOSS. The most common ways of specifying a sequence is to type (database:entry), where database can be embl, uniprot or swissprot and entry is either the sequence`s entry or ID name, or its Accession number in that database. For example, database:accession -->embl:X65923 or swissprot:Q7M4G0 | database:entry_name -->swissprot:AMIC_PSEAE |database:ID_name -->embl:paamir. Choose either this parameter or the seqall_direct_data parameter but not both together. Parameter mandatory if the seqall_direct_data parameter has not been chosen. false http://www.mygrid.org.uk/ontology#EMBL_accession String seqall_direct_data Type: string. DNA sequence. Choose this parameter if you want to provide the 'seqall' value as string (DNA sequence). Parameter mandatory if the seqall_usa parameter hasn't been chosen. false http://www.mygrid.org.uk/ontology#DNA_sequence http://www.mygrid.org.uk/ontology#single_sequence_format String sformat Type: string. Specifies the format of the input sequence. This is an optional parameter. The allowed values for this parameter are: gcg, gcg8, embl, swiss, fasta, ncbi, genbank, nbrf, pir, codata, strider, clustal, phylip, acedb, msf, jackknifer, jackknifernon, nexus, nexusnon, treecon, mega, meganon, ig, staden, text, raw. By default the service autodetects the sequence format. false String sbegin Type: long. The first position to be used in the sequence, for example: sbegin=1 (default value) means start with the first base in the sequence. This is an optional parameter. false String send Type: long. The last position to be used in the sequence. This is an optional parameter. By default it is the end the sequence. false String sprotein Type: boolean. Is the sequence a protein? This is an optional parameter. By default the service can autodetect if a sequence is a nucleotide or protein sequence. false String snucleotide Type: boolean. Is the sequence a nucleotide? This is an optional parameter. By default the service can autodetect if a sequence is a nucleotide or protein sequence. false String sreverse Type: boolean. Use reverse complement of the nucleic acid sequence. This is an optional parameter. False by default. false String slower Type: boolean. Convert the sequence to lower case. This is an optional parameter. False by default. false String supper Type: boolean. Convert the sequence to UPPER case. This is an optional parameter. String infile_direct_data Type: string. Primer pairs. The primers Pair consists of three columns separated by tabs or spaces. The first column is the name of the primer pair. The second column is the sequence of the first primer. The third column is the sequence of the second primer. For example: PrimA ACCAGACACCCATCAACAG TATTTATGCCAGCCAGCCAG | PrimB CGAAAGAATAAGAGCAGGCAAG GTAAGAGAAATAGACAGGCGG | This is a mandatory parameter and mutually exclusive with the 'infile_url' parameter false http://www.mygrid.org.uk/ontology#DNA_sequence String infile_url Type: string. URL of Primer pairs. The primers Pair consists of three columns separated by tabs or spaces. The first column is the name of the primer pair. The second column is the sequence of the first primer. The third column is the sequence of the second primer. For example: PrimA ACCAGACACCCATCAACAG TATTTATGCCAGCCAGCCAG | PrimB CGAAAGAATAAGAGCAGGCAAG GTAAGAGAAATAGACAGGCGG | This parameter is mutually exclusive with the 'infile_direct_data' parameter. false String mismatchpercent Type: long. Allowed percent mismatch. This is an optional parameter. The default is 0. 0 false String report Type: string. A general report for the underlying analysis job. String detailed_status Type: long. The exit code of the underlying analysis job, 0 means the job returned normally. String outfile Returns matches between primers and specified DNA sequences. false http://www.mygrid.org.uk/ontology#primer_report String http://www.mygrid.org.uk/ontology#pairwise_local_aligning http://www.mygrid.org.uk/ontology#EMBL_nucleotide_sequence_database Soaplab service