eprimer3 European Bioinformatics Institute http://www.ebi.ac.uk/soaplab/emboss4/services/nucleic_primers.eprimer3 http://www.ebi.ac.uk/soaplab/emboss4/services/nucleic_primers.eprimer3?wsdl Picks PCR primers and hybridization oligos. Detailed info about this operation can be found at the following link: http://emboss.sourceforge.net/apps/release/4.0/emboss/apps/eprimer3.html eprimer3 Picks PCR primers and hybridization oligos. Detailed info about this operation can be found at the following link: http://emboss.sourceforge.net/apps/release/4.0/emboss/apps/eprimer3.html sequence_usa Type: string. The sequence from which to choose primers. The sequence must be presented 5' to 3' DNA sequence. The Uniform Sequence Address, or USA, is a standard way of specifying a sequence to be read into a program in EMBOSS. The most common ways of specifying a sequence is to type (database:entry), where database can be embl, uniprot or swissprot and entry is either the sequence`s entry or ID name, or its Accession number in that database. For example, database:accession -->embl:X65923 or swissprot:Q7M4G0 | database:entry_name -->swissprot:AMIC_PSEAE |database:ID_name -->embl:paamir. Choose either this parameter or the sequence_direct_data parameter but not both together. Parameter mandatory if the sequence_direct_data parameter has not been chosen. false http://www.mygrid.org.uk/ontology#EMBL_accession String sequence_direct_data Type: string. The sequence from which to choose primers. The sequence must be presented 5' to 3' DNA sequence. Choose this parameter if you want to provide the 'sequence' value as string (DNA sequence). Parameter mandatory if the sequence_usa parameter hasn't been chosen. false http://www.mygrid.org.uk/ontology#DNA_sequence http://www.mygrid.org.uk/ontology#single_sequence_format String sformat Type: string. Specifies the format of the input sequence. This is an optional parameter. The allowed values for this parameter are: gcg, gcg8, embl, swiss, fasta, ncbi, genbank, nbrf, pir, codata, strider, clustal, phylip, acedb, msf, jackknifer, jackknifernon, nexus, nexusnon, treecon, mega, meganon, ig, staden, text, raw. By default the service autodetects the sequence format. false String sbegin Type: long. The first position to be used in the sequence, for example: sbegin=1 (default value) means start with the first base in the sequence. This is an optional parameter. false String send Type: long. The last position to be used in the sequence. This is an optional parameter. By default it is the end the sequence. false String sprotein Type: boolean. Is the sequence a protein? This is an optional parameter. By default the service can autodetect if a sequence is a nucleotide or protein sequence. false String snucleotide Type: boolean. Is the sequence a nucleotide? This is an optional parameter. By default the service can autodetect if a sequence is a nucleotide or protein sequence. false String sreverse Type: boolean. Use reverse complement of the nucleic acid sequence. This is an optional parameter. False by default. false String slower Type: boolean. Convert the sequence to lower case. This is an optional parameter. False by default. false String supper Type: boolean. Convert the sequence to UPPER case. This is an optional parameter. False by default. false String primer Type: boolean (yes/no). Tell the service to pick primer(s). This is an optional parameter. The default is 'yes'. Y false String task Type: long. Tell the service what task to perform. This is an optional parameter. Possible values are: 1: 'Pick PCR primers'| 2: 'Pick forward primer only'| 3: 'Pick reverse primer only'| 4: 'No primers needed'. The default is 1. 1 false String hybridprobe Type: boolean (yes/no). An 'internal oligo' is intended to be used as a hybridization probe (hyb probe) to detect the PCR product after amplification. This is an optional parameter. The default is 'no'. N false String oligomishyblibraryfile_direct_data Type: string. Primer3 internal oligo mishybridizing library. The file must be in (a slightly restricted) FASTA format. There are no restrictions on line length. An empty value for this parameter indicates that no library should be used. This is an optional parameter. false http://www.mygrid.org.uk/ontology#DNA_sequence http://www.mygrid.org.uk/ontology#fasta_format String oligomishyblibraryfile_url Type: string. URL of Primer3 internal oligo mishybridizing library. The file must be in (a slightly restricted) FASTA format. There are no restrictions on line length. An empty value for this parameter indicates that no library should be used. This is an optional parameter. false String mispriminglibraryfile_direct_data Type: string. Primer3 mispriming library. A nucleotide sequence library of sequences to avoid amplifying (for example repetitive sequences, or possibly the sequences of genes in a gene family that should not be amplified.) sequence must be in (a slightly restricted) FASTA format. There are no restrictions on line length. An empty value for this parameter indicates that no library should be used. This is an optional parameter. false http://www.mygrid.org.uk/ontology#DNA_sequence http://www.mygrid.org.uk/ontology#fasta_format String mispriminglibraryfile_url Type: string. URL of Primer3 mispriming library. A nucleotide sequence library of sequences to avoid amplifying (for example repetitive sequences, or possibly the sequences of genes in a gene family that should not be amplified.) sequence must be in (a slightly restricted) FASTA format. There are no restrictions on line length. An empty value for this parameter indicates that no library should be used. This is an optional parameter. false String numreturn Type: long. The maximum number of primer pairs to return. Primer pairs returned are sorted by their 'quality', in other words by the value of the objective function (where a lower number indicates a better primer pair). Caution: setting this parameter to a large value will increase running time. This is an optional parameter. The default is 5. 5 false String includedregion Type: string. A sub-region of the given sequence in which to pick primers. For example, often the first dozen or so bases of a sequence are vector, and should be excluded from consideration. The value for this parameter has the form (start),(end) where (start) is the index of the first base to consider, and (end) is the last in the primer-picking region. This is an optional parameter. The default is the full sequence. false String target Type: string. If one or more targets is specified then a legal primer pair must flank at least one of them. A target might be a simple sequence repeat site (for example a CA repeat) or a single-base-pair polymorphism. The value should be a space-separated list of (start),(end) pairs where (start) is the index of the first base of a Target, and (end) is the last E.g. 50,51 requires primers to surround the 2 bases at positions 50 and 51. This is an optional parameter. The default is the full sequence. false String excludedregion Type: string. Primer oligos may not overlap any region specified in this tag. The associated value must be a space-separated list of (start),(end) pairs where (start) is the index of the first base of the excluded region, and and (end) is the last. This tag is useful for tasks such as excluding regions of low sequence quality or for excluding regions containing repetitive elements such as ALUs or LINEs. E.g. 401,407 68,70 forbids selection of primers in the 7 bases starting at 401 and the 3 bases at 68. This is an optional parameter. The default is the full sequence. false String forwardinput Type: string. The sequence of a forward primer to check and around which to design reverse primers and optional internal oligos. Must be a substring of SEQUENCE. This is an optional parameter. false http://www.mygrid.org.uk/ontology#nucleotide_sequence String reverseinput Type: string. The sequence of a reverse primer to check and around which to design forward primers and optional internal oligos. Must be a substring of the reverse strand of SEQUENCE. This is an optional parameter. false http://www.mygrid.org.uk/ontology#nucleotide_sequence String gcclamp Type: long. Require the specified number of consecutive Gs and Cs at the 3' end of both the forward and reverse primer. (This parameter has no effect on the internal oligo if one is requested.). This is an optional parameter. The default is 0. 0 false String osize Type: long. Optimum length (in bases) of a primer oligo. The service will attempt to pick primers close to this length. This is an optional parameter. The default is 20. 20 false String minsize Type: long. Minimum acceptable length of a primer. Must be greater than 0 and less than or equal to MAX-SIZE. This is an optional parameter. The default is 18. 18 false String maxsize Type: long. Maximum acceptable length (in bases) of a primer. Currently this parameter cannot be larger than 35. This limit is governed by the maximum oligo size for which EPrimer3's melting-temperature is valid. This is an optional parameter. The default is 27. 27 true String otm Type: float.Optimum melting temperature(Celsius) for a primer oligo. EPrimer3 will try to pick primers which melting temperatures are close to this temperature. The oligo melting temperature formula in EPrimer3 is that given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 12, pp 6409-6412 and Breslauer, Frank, Bloeker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. This is an optional parameter. The default is 60.0. 60.0 false String mintm Type: float. Minimum acceptable melting temperature(Celsius) for a primer oligo. This is an optional parameter. The default is 57.0. 57.0 false String maxtm Type: float. Maximum acceptable melting temperature(Celsius) for a primer oligo. This is an optional parameter. The default is 63.0. 63.0 false String maxdifftm Type: float. Maximum acceptable (unsigned) difference between the melting temperatures of the forward and reverse primers. This is an optional parameter. The default is 100.0. 100.0 false String ogcpercent Type: float. Primer optimum GC percent. This is an optional parameter. The default is 50.0. 50.0 false String mingc Type: float. Minimum allowable percentage of Gs and Cs in any primer. This is an optional parameter. The default is 20.0. 20.0 false String maxgc Type: float. Maximum allowable percentage of Gs and Cs in any primer. This is an optional parameter. The default is 80.0. 80.0 false String saltconc Type: float. The millimolar concentration of salt (usually KCl) in the PCR. The service uses this argument to calculate oligo melting temperatures. This is an optional parameter. The default is 50.0. 50.0 false String dnaconc Type: float. The nanomolar concentration of annealing oligos in the PCR. The service uses this argument to calculate oligo melting temperatures. The default (50nM) works well with the standard protocol used at the Whitehead/MIT Center for Genome Research--0.5 microliters of 20 micromolar concentration for each primer oligo in a 20 microliter reaction with 10 nanograms template, 0.025 units/microliter Taq polymerase in 0.1 mM each dNTP, 1.5mM MgCl2, 50mM KCl, 10mM Tris-HCL (pH 9.3) using 35 cycles with an annealing temperature of 56 degrees Celsius. This parameter corresponds to 'c' in Rychlik, Spencer and Rhoads' equation (ii) (Nucleic Acids Research, vol 18, num 12) where a suitable value (for a lower initial concentration of template) is 'empirically determined'. The value of this parameter is less than the actual concentration of oligos in the reaction because it is the concentration of annealing oligos, which in turn depends on the amount of template (including PCR product) in a given cycle. This concentration increases a great deal during a PCR; fortunately PCR seems quite robust for a variety of oligo melting temperatures. This is an optional parameter. 50.0 false String maxpolyx Type: long. The maximum allowable length of a mononucleotide repeat in a primer, for example AAAAAA. This is an optional parameter. The default is 5. 5 false String productosize Type: long. The optimum size for the PCR product. 0 indicates that there is no optimum product size. This is an optional parameter. The default is 200. 200 false String productsizerange Type: string. The associated values specify the lengths of the product that the user wants the primers to create, and is a space separated list of elements of the form (x)-(y) where an (x)-(y) pair is a legal range of lengths for the product. For example, if one wants PCR products to be between 100 to 150 bases (inclusive) then one would set this parameter to 100-150. If one desires PCR products in either the range from 100 to 150 bases or in the range from 200 to 250 bases then one would set this parameter to 100-150 200-250. This is an optional parameter. The default is 100-300. 100-300 false String productotm Type: float. The optimum melting temperature for the PCR product. 0 indicates that there is no optimum temperature. This is an optional parameter. The default is 0.0 0.0 false String productmintm Type: float. The minimum allowed melting temperature of the amplicon. Please see the documentation on the maximum melting temperature of the product for details. This is an optional parameter. The default is -1000000.0 -1000000.0 false String productmaxtm Type: float. The maximum allowed melting temperature of the amplicon. Product Tm is calculated using the formula from Bolton and McCarthy, PNAS 84:1390 (1962) as presented in Sambrook, Fritsch and Maniatis, Molecular Cloning, p 11.46 (1989, CSHL Press). Tm = 81.5 + 16.6(log10([Na+])) + .41*(%GC) - 600/length Where [Na+} is the molar sodium concentration, (%GC) is the percent of Gs and Cs in the sequence, and length is the length of the sequence. This is an optional parameter. The default is 1000000.0 1000000.0 false String oligoexcludedregion Type: string. Middle oligos may not overlap any region specified by this tag. The associated value must be a space-separated list of (start),(end) pairs, where (start) is the index of the first base of an excluded region, and (end) is the last. Often one would make Target regions excluded regions for internal oligos. This is an optional parameter. The default is the full sequence. false String oligoinput Type: string. The sequence of an internal oligo to check and around which to design forward and reverse primers. Must be a substring of SEQUENCE. This is an optional parameter. false String oligoosize Type: long. Optimum length (in bases) of an internal oligo. The service will attempt to pick primers close to this length. This is an optional parameter. The default is 20. 20 false String oligominsize Type: long. Minimum acceptable length of an internal oligo. Must be greater than 0 and less than or equal to INTERNAL-OLIGO-MAX-SIZE. This is an optional parameter. The default is 18. 18 false String oligomaxsize Type: long. Maximum acceptable length (in bases) of an internal oligo. Currently this parameter cannot be larger than 35. This limit is governed by maximum oligo size for which EPrimer3's melting-temperature is valid. This is an optional parameter. The default is 27. 27 false String oligootm Type: float. Optimum melting temperature (Celsius) for an internal oligo. EPrimer3 will try to pick oligos with melting temperatures that are close to this temperature. The oligo melting temperature formula in EPrimer3 is that given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 12, pp 6409-6412 and Breslauer, Frank, Bloeker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. This is an optional parameter. The default is 60.0 60.0 false String oligomintm Type: float. Minimum acceptable melting temperature(Celsius) for an internal oligo. This is an optional parameter. The default is 57.7 57.0 false String oligomaxtm Type: float. Maximum acceptable melting temperature (Celsius) for an internal oligo. This is an optional parameter. The default is 63.0 63.0 false String oligoogcpercent Type: float. Internal oligo optimum GC percent. This is an optional parameter. The default is 50.0 50.0 false String oligomingc Type: float. Minimum allowable percentage of Gs and Cs in an internal oligo. This is an optional parameter. The default is 20.0 20.0 false String oligomaxgc Type: float. Maximum allowable percentage of Gs and Cs in any internal oligo generated by Primer. This is an optional parameter. The default is 80.0. 80.0 false String oligosaltconc Type: float. The millimolar concentration of salt (usually KCl) in the hybridization. EPrimer3 uses this argument to calculate internal oligo melting temperatures. This is an optional parameter. The default is 50.0 50.0 false String oligodnaconc Type: float. The nanomolar concentration of annealing internal oligo in the hybridization. This is an optional parameter. The default is 50.0 50.0 false String oligoselfany Type: float. The maximum allowable local alignment score when testing an internal oligo for (local) self-complementarity. Local self-complementarity is taken to predict the tendency of oligos to anneal to themselves The scoring system gives 1.00 for complementary bases, -0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a gap. Only single-base-pair gaps are allowed. For example, the alignment 5' ATCGNA 3' || | | 3' TA-CGT 5' is allowed (and yields a score of 1.75), but the alignment 5' ATCCGNA 3' || | | 3' TA--CGT 5' is not considered. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos. This is an optional parameter. The default is 12.0 12.0 false String oligoselfend Type: float. The maximum allowable 3'-anchored global alignment score when testing a single oligo for self-complementarity. The scoring system is as for the Maximum Complementarity argument. This is an optional parameter. The default is 12.0 12.0 false String oligomaxpolyx Type: long. The maximum allowable length of an internal oligo mononucleotide repeat, for example AAAAAA. This is an optional parameter. The default is 5. 5 false String oligomaxmishyb Type: float. Similar to MAX-MISPRIMING except that this parameter applies to the similarity of candidate internal oligos to the library specified in INTERNAL-OLIGO-MISHYB-LIBRARY. This is an optional parameter. The default is 12.0 12.0 false String explainflag Type: boolean (true/false). If this flag is true, produce LEFT-EXPLAIN, RIGHT-EXPLAIN, and INTERNAL-OLIGO-EXPLAIN output tags, which are intended to provide information on the number of oligos and primer pairs that EPrimer3 examined, and statistics on the number discarded for various reasons. This is an optional parameter. The default is 'false'. false false String fileflag Type: boolean (true/false). If the associated value is true, then EPrimer3 creates two output files for each input SEQUENCE. File (sequence-id) lists all acceptable forward primers for(sequence-id), and (sequence-id).rev lists all acceptable reverse primers for (sequence-id), where (sequence-id) is the value of the SEQUENCE-ID tag (which must be supplied). In addition, if the input tag TASK is 1 or 4, EPrimer3 produces a file (sequence-id).int, which lists all acceptable internal oligos. This is an optional parameter. The default is 'false'. false false String firstbaseindex Type: long. This parameter is the index of the first base in the input sequence. For input and output using 1-based indexing (such as that used in GenBank and to which many users are accustomed) set this parameter to 1. For input and output using 0-based indexing set this parameter to 0. (This parameter also affects the indexes in the contents of the files produced when the primer file flag is set.) This is an optional parameter. The default is 1. 1 false String pickanyway Type: boolean (true/false). If true pick a primer pair even if LEFT-INPUT, RIGHT-INPUT, or INTERNAL-OLIGO-INPUT violates specific constraints. This is an optional parameter. The default is 'false'. false false String maxmispriming Type: float. The maximum allowed weighted similarity with any sequence in MISPRIMING-LIBRARY. This is an optional parameter. The default is 12.0. 12.0 false String pairmaxmispriming Type: float. The maximum allowed sum of weighted similarities of a primer pair (one similarity for each primer) with any single sequence in MISPRIMING-LIBRARY. This is an optional parameter. The default is 24.0 24.0 false String numnsaccepted Type: long. Maximum number of unknown bases (N) allowable in any primer. This is an optional parameter. The default is 0. 0 false String selfany Type: float. The maximum allowable local alignment score when testing a single primer for (local) self-complementarity and the maximum allowable local alignment score when testing for complementarity between forward and reverse primers. Local self-complementarity is taken to predict the tendency of primers to anneal to each other without necessarily causing self-priming in the PCR. The scoring system gives 1.00 for complementary bases, -0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a gap. Only single-base-pair gaps are allowed. For example, the alignment 5' ATCGNA 3' ...|| | | 3' TA-CGT 5' is allowed (and yields a score of 1.75), but the alignment 5' ATCCGNA 3' ...|| | | 3' TA--CGT 5' is not considered. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos. This is an optional parameter. The default is 8.0 8.0 false String selfend Type: float. The maximum allowable 3'-anchored global alignment score when testing a single primer for self-complementarity, and the maximum allowable 3'-anchored global alignment score when testing for complementarity between forward and reverse primers. The 3'-anchored global alignment score is taken to predict the likelihood of PCR-priming primer-dimers, for example 5' ATGCCCTAGCTTCCGGATG 3' .............||| ||||| ..........3' AAGTCCTACATTTAGCCTAGT 5' or 5' AGGCTATGGGCCTCGCGA 3' ...............|||||| ............3' AGCGCTCCGGGTATCGGA 5' The scoring system is as for the Maximum Complementarity argument. In the examples above the scores are 7.00 and 6.00 respectively. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable 3'-anchored global alignment between two oligos. In order to estimate 3'-anchored global alignments for candidate primers and primer pairs, Primer assumes that the sequence from which to choose primers is presented 5' to 3'. It is nonsensical to provide a larger value for this parameter than for the Maximum (local) Complementarity parameter because the score of a local alignment will always be at least as great as the score of a global alignment. This is an optional parameter. The default is 3.0 3.0 false String maxendstability Type: float. The maximum stability for the five 3' bases of a forward or reverse primer. Bigger numbers mean more stable 3' ends. The value is the maximum delta G for duplex disruption for the five 3' bases as calculated using the nearest neighbor parameters published in Breslauer, Frank, Bloeker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. This is an optional parameter. The default is 9.0 9.0 false String report Type: string. A general report for the underlying analysis job. String detailed_status Type: long. The exit code of the underlying analysis job, 0 means the job returned normally. String outfile Returns PCR primers and hybridization oligos. http://www.mygrid.org.uk/ontology#primer_report String http://www.mygrid.org.uk/ontology#predicting http://www.mygrid.org.uk/ontology#EMBL_nucleotide_sequence_database Soaplab service